View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5209_low_10 (Length: 272)

Name: NF5209_low_10
Description: NF5209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5209_low_10
NF5209_low_10
[»] chr3 (1 HSPs)
chr3 (159-267)||(26610056-26610164)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 159 - 267
Target Start/End: Complemental strand, 26610164 - 26610056
Alignment:
159 ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggtttggtatacttagg 258  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||    
26610164 ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttgtatacttagg 26610065  T
259 tctcttgtt 267  Q
    |||||||||    
26610064 tctcttgtt 26610056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University