View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5210-Insertion-3 (Length: 354)
Name: NF5210-Insertion-3
Description: NF5210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5210-Insertion-3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 346
Target Start/End: Complemental strand, 7544811 - 7544473
Alignment:
| Q |
8 |
aaactttccccgacgcggtaatggccggacaagttcccagcaactcttttcaccaccgtcctccgcggtaaacttcggcaccgacatcgtcaccttccga |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
7544811 |
aaactttccccgacgccgtaatggccggacaagttcccagaaactcttttcaccaccgtcctccgcggtaaacttcggcaccgtcatcgccaacttccga |
7544712 |
T |
|
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactcttcctatcactgctacttctctgcc |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544711 |
tcttgcctcgtcttcatatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgctacttctctgcc |
7544612 |
T |
|
| Q |
208 |
accggctttccctcccggatggcgaccggagtccagcaacaaagacattatgccgatcagacgtgttttcttcctcccttttcaacatctgccttgctga |
307 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
7544611 |
accggttttccctcccggatggcgaccgcagtccggcaacaaagacattatgccgatcagacgtgtcttcttcctctcttttcatcatctgcctagctga |
7544512 |
T |
|
| Q |
308 |
accgggttcggtttggcgagtgatgagttttccacagaa |
346 |
Q |
| |
|
||||||||| |||| |||| | ||||||||||||||||| |
|
|
| T |
7544511 |
accgggttcagtttcgcgacttatgagttttccacagaa |
7544473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 346
Target Start/End: Complemental strand, 7554589 - 7554251
Alignment:
| Q |
8 |
aaactttccccgacgcggtaatggccggacaagttcccagcaactcttttcaccaccgtcctccgcggtaaacttcggcaccgacatcgtcaccttccga |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
7554589 |
aaactttccccgacgccgtaatggccggataagttcccagcaactcttttcaccaccgtcctctgcggtaaacttcggcaccgtcatcgccaacttccga |
7554490 |
T |
|
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactcttcctatcactgctacttctctgcc |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554489 |
tcttgcctcgtcttcatatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgctacttctctgcc |
7554390 |
T |
|
| Q |
208 |
accggctttccctcccggatggcgaccggagtccagcaacaaagacattatgccgatcagacgtgttttcttcctcccttttcaacatctgccttgctga |
307 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
7554389 |
accggttttccctcccggatggcgaccgcagtccggcaacaaagacattatgccgatcagacgtgttttcttcctctcttttcatcatctgcctagctga |
7554290 |
T |
|
| Q |
308 |
accgggttcggtttggcgagtgatgagttttccacagaa |
346 |
Q |
| |
|
||||||||| |||| |||| | ||||||||||||||||| |
|
|
| T |
7554289 |
accgggttcagtttcgcgacttatgagttttccacagaa |
7554251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7558957 - 7558881
Alignment:
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactctt |
184 |
Q |
| |
|
||||||||| | || ||||||||||| |||||||| || |||||||| || ||||||| ||||| || |||||||| |
|
|
| T |
7558957 |
tcttgcctcattttaatatcactcaactccatttgtaacggaaacttcaccatcccaaacatacctgtgtaactctt |
7558881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7563088 - 7563012
Alignment:
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactctt |
184 |
Q |
| |
|
||||||||| | || ||||||||||| |||||||| || |||||||| || ||||||| ||||| || |||||||| |
|
|
| T |
7563088 |
tcttgcctcattttaatatcactcaactccatttgtaacggaaacttcaccatcccaaacatacctgtgtaactctt |
7563012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University