View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5210-Insertion-4 (Length: 96)
Name: NF5210-Insertion-4
Description: NF5210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5210-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 11 - 92
Target Start/End: Complemental strand, 4206954 - 4206873
Alignment:
| Q |
11 |
aaaataccaatttgcttgggttcccaccaatagataaaccaagatatttaaacataatttttctctaagttttcattagaaa |
92 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4206954 |
aaaataccaattttcttgggttcccaccaatagacaaaccaagatatttaaacataatttttctctaagttttcattagaaa |
4206873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University