View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5210_high_7 (Length: 244)
Name: NF5210_high_7
Description: NF5210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5210_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 41894845 - 41894614
Alignment:
| Q |
13 |
tgacatgttcaataatcttctacttctccagtttttcatttatagttgctacagtgtttcactaatttactctaaagtaataaattaataaactttttct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41894845 |
tgacatgttcaataatcttctacttctccagtttttcatttatagttgctacagtgtttcactaatttactctaaattaataaattaataaactttttct |
41894746 |
T |
 |
| Q |
113 |
tgtcaataaatcatatactcagtatataccttgcttttgttttacagatctcatcttttagagagagcaaatcagatgacagaaaattctacatattcac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41894745 |
tgtcaataaatcatatactcagtatataccttgcttttgttttacagatctcatcttttagagagagcaaatcagatgacagaaaattctacatattcac |
41894646 |
T |
 |
| Q |
213 |
agcaacaaagacacttcatttgagaactgatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41894645 |
agcaacaaagacacttcatttgagaactgatt |
41894614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University