View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5210_low_10 (Length: 205)
Name: NF5210_low_10
Description: NF5210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5210_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 24 - 190
Target Start/End: Original strand, 14633234 - 14633400
Alignment:
| Q |
24 |
ggactctcgtttgattcttactctttgccttatgttttgaaatctgttgtttgtttaaatgattttggtttggggaaacaaattcattgtgttggtgttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14633234 |
ggactctcgtttgattcttactctttgccttatgttttgaaatctgttgtttgtttaaatgattttggtttggggaaacaaattcattgtgttggtgttg |
14633333 |
T |
 |
| Q |
124 |
ttactggtttggataagaatgttagtgttgttagttcgttgattcagatgtattcttgtgatgatgt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
14633334 |
ttactggtttggataagaatgttagtgtttgtagttcgttgattcaaatgtattcttgttatgatgt |
14633400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University