View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5210_low_5 (Length: 270)
Name: NF5210_low_5
Description: NF5210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5210_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 27888553 - 27888296
Alignment:
| Q |
18 |
taaagaaaataaaaaaggtatttaatttttatcttcttgaattatgatgttgaaaagta----------------agtagaaaagggttaaaggacatgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27888553 |
taaagaaaataaaaaaggtatttaatctttatcttcttgaattatgatgttgaaaagtagggagaaagaaaagtaagtagaaaagggttaaaggacatgt |
27888454 |
T |
 |
| Q |
102 |
cactgaagcagtcaatggaagatgcatgcaacacattagagggggattctttccggtttgtttcctctttgcccctttgattaagttaaaacctttccat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27888453 |
cactgaagcagtcaatggaagatgcatgcaacacattagagggggattctttccagtttgtttcctctttgcccctttaattaagttaaaacctttccat |
27888354 |
T |
 |
| Q |
202 |
acgctgatgtgatctttcttcaaatgcatttattatgatttaggtcaattagagtatt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27888353 |
acgctgatgtgatctttcttcaaatgcatttattatgatgtaggtcaattagagtatt |
27888296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University