View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5211-Insertion-5 (Length: 196)
Name: NF5211-Insertion-5
Description: NF5211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5211-Insertion-5 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 8 - 196
Target Start/End: Complemental strand, 7544811 - 7544623
Alignment:
| Q |
8 |
aaactttccccgacgcggtaatggccggacaagttcccagcaactcttttcaccaccgtcctccgcggtaaacttcggcaccgacatcgtcaccttccga |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
7544811 |
aaactttccccgacgccgtaatggccggacaagttcccagaaactcttttcaccaccgtcctccgcggtaaacttcggcaccgtcatcgccaacttccga |
7544712 |
T |
|
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactcttcctatcactgct |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7544711 |
tcttgcctcgtcttcatatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgct |
7544623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 149; E-Value: 6e-79
Query Start/End: Original strand, 8 - 196
Target Start/End: Complemental strand, 7554589 - 7554401
Alignment:
| Q |
8 |
aaactttccccgacgcggtaatggccggacaagttcccagcaactcttttcaccaccgtcctccgcggtaaacttcggcaccgacatcgtcaccttccga |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
7554589 |
aaactttccccgacgccgtaatggccggataagttcccagcaactcttttcaccaccgtcctctgcggtaaacttcggcaccgtcatcgccaacttccga |
7554490 |
T |
|
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactcttcctatcactgct |
196 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554489 |
tcttgcctcgtcttcatatcactcagttccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgct |
7554401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7558957 - 7558881
Alignment:
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactctt |
184 |
Q |
| |
|
||||||||| | || ||||||||||| |||||||| || |||||||| || ||||||| ||||| || |||||||| |
|
|
| T |
7558957 |
tcttgcctcattttaatatcactcaactccatttgtaacggaaacttcaccatcccaaacatacctgtgtaactctt |
7558881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 184
Target Start/End: Complemental strand, 7563088 - 7563012
Alignment:
| Q |
108 |
tcttgcctcgtcttcatatcactcaaatccatttgcaatggaaactttacagtcccaaatataccagtataactctt |
184 |
Q |
| |
|
||||||||| | || ||||||||||| |||||||| || |||||||| || ||||||| ||||| || |||||||| |
|
|
| T |
7563088 |
tcttgcctcattttaatatcactcaactccatttgtaacggaaacttcaccatcccaaacatacctgtgtaactctt |
7563012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University