View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5211_low_5 (Length: 226)

Name: NF5211_low_5
Description: NF5211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5211_low_5
NF5211_low_5
[»] chr2 (1 HSPs)
chr2 (17-210)||(28805522-28805715)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 28805715 - 28805522
Alignment:
17 aaaatcatgttaaagtattatctcttccaatgtgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattgggaa 116  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
28805715 aaaatcatgttaaagtattatctcttccaatgcgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattggcaa 28805616  T
117 agaaagaacacaaaccttgaggataaattcctttgagaaaaacaacagaagtaatagcaacttccaaaaattcaaccaaaacccgacctatttg 210  Q
    |||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28805615 agaaagaacacaaaccttgaggataaatccctttaagaaaaacaacagaggtaatagcaacttccaaaaattcaaccaaaacccgacctatttg 28805522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University