View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5212-Insertion-19 (Length: 311)
Name: NF5212-Insertion-19
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5212-Insertion-19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 8 - 311
Target Start/End: Original strand, 1248064 - 1248367
Alignment:
| Q |
8 |
ggatattcaatatcggatttatgtgcatgaatatgattgcttatataagaatacatacctcactgagcaaggtgcctagagacttatcgtcggaggcctt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1248064 |
ggatattcaatatcggatttatgtgcatgaatatgattgcttatataagaatacatacctcactgagcaaggtgcctagagacttatcgtcagaggcctt |
1248163 |
T |
 |
| Q |
108 |
aacggtctcctcagctttggtctccttggcttgctgttcaaccttaacctcctcggtgacaggctcggggacagggactggagcgtcactttcgtcggtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1248164 |
aacggtctcctcagctttggtctccttggcttgctgttcaaccttaacctcctcggtgacaggctcagggacagggactggagcgtcactttcgtcggtc |
1248263 |
T |
 |
| Q |
208 |
ctagggttgccagcacagttgcccattttcaatgattattattaataaatgtacaatgtgggagaacaagccaagtaatttggtcttgttcttgatttgt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1248264 |
ctagggttgccagcacagttgcccattttcaatgattattattaataaatgtacaatgtgggagaacaagccaagtaagttggtcttgttcttgatttgt |
1248363 |
T |
 |
| Q |
308 |
tctc |
311 |
Q |
| |
|
|||| |
|
|
| T |
1248364 |
tctc |
1248367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University