View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5212-Insertion-23 (Length: 113)

Name: NF5212-Insertion-23
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5212-Insertion-23
NF5212-Insertion-23
[»] chr3 (2 HSPs)
chr3 (10-89)||(47310376-47310455)
chr3 (86-113)||(47310291-47310318)
[»] chr5 (1 HSPs)
chr5 (8-63)||(31338362-31338417)


Alignment Details
Target: chr3 (Bit Score: 68; Significance: 7e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 7e-31
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 47310455 - 47310376
Alignment:
10 atctccaacaagtgacgaatttgatttaccgacgctcaacccaagcgactatctaacttacttgacttcatgatttgctc 89  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||    
47310455 atctccaacaagtgacgaatttgatttaccgacgctcgacccaagcgactatgtaacttacttgacttcatgatctgctc 47310376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 86 - 113
Target Start/End: Complemental strand, 47310318 - 47310291
Alignment:
86 gctcaaaccgtaaaaaacttttcacaat 113  Q
    ||||||||||||||||||||||||||||    
47310318 gctcaaaccgtaaaaaacttttcacaat 47310291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 31338362 - 31338417
Alignment:
8 ccatctccaacaagtgacgaatttgatttaccgacgctcaacccaagcgactatct 63  Q
    |||||||||| ||| ||||||||| ||| ||  |||||| ||||||||||||||||    
31338362 ccatctccaataagcgacgaattttattaactaacgctctacccaagcgactatct 31338417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University