View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5212_high_18 (Length: 236)
Name: NF5212_high_18
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5212_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 2525146 - 2525340
Alignment:
| Q |
1 |
tggacccggccatggaataaggttatgcaatataataattgaattatagtttattctattccattttatagctcatatgcaaataagaaaagcaaagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2525146 |
tggacccggccatggaataaggttatgcaatataataattgaattatagtttattctattccattttatagctcatatgcaaataagaaaagcaaggata |
2525245 |
T |
 |
| Q |
101 |
tgaaatttatttatcttatgttatactgatatgatatttatcttatttttagataagcactatgatattattacgatttaattatatttgagaaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
2525246 |
tgaaatttatttatcttatgttatactgatatgatatttatcttatttttagataagcactatgatattattatgatttaattatattttagaaa |
2525340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University