View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5212_high_18 (Length: 236)

Name: NF5212_high_18
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5212_high_18
NF5212_high_18
[»] chr8 (1 HSPs)
chr8 (1-195)||(2525146-2525340)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 2525146 - 2525340
Alignment:
1 tggacccggccatggaataaggttatgcaatataataattgaattatagtttattctattccattttatagctcatatgcaaataagaaaagcaaagata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2525146 tggacccggccatggaataaggttatgcaatataataattgaattatagtttattctattccattttatagctcatatgcaaataagaaaagcaaggata 2525245  T
101 tgaaatttatttatcttatgttatactgatatgatatttatcttatttttagataagcactatgatattattacgatttaattatatttgagaaa 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||    
2525246 tgaaatttatttatcttatgttatactgatatgatatttatcttatttttagataagcactatgatattattatgatttaattatattttagaaa 2525340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University