View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5212_high_8 (Length: 344)
Name: NF5212_high_8
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5212_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 17 - 337
Target Start/End: Original strand, 32779181 - 32779501
Alignment:
| Q |
17 |
aattttgagtcttgagaaccaactcttgcatcggtagaaagaggaggggtggatgaaagttgatgaggcaaaggtctaacagaggagtttggatgcaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32779181 |
aattttgagtcttgagaaccaactcttgcatcggtagaaagaggaggggtggatgaaagttgatgaggcaaaggtctaacagaggagtttggatgcaatg |
32779280 |
T |
 |
| Q |
117 |
tatgcaactcctgtggaatggaaacaacaccaccaccaccacctccattttcagagtgaaaactgttgctttcgctgaaccttctgctcggaagagctcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32779281 |
tatgcaactcctgtggaatggaaacaacaccaccaccaccacctccattttcagagtgaaaactgttgctttggctgaaccttctgctcggaagagctcg |
32779380 |
T |
 |
| Q |
217 |
atctccaatgtcaccggcttctgaaacactctcgcaatcaataccgttatctgtgtgatggcttctatgacttgacatgctcaacgaacgccttttaatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32779381 |
atctccaatgtcaccggcttctgaaacactctcgcaatcaataccgttatctgtgtgatggcttctatgacttgacatgctcaacgaacgccttttaatt |
32779480 |
T |
 |
| Q |
317 |
gaagaaccgccatctctgctc |
337 |
Q |
| |
|
|||||||| ||||| |||||| |
|
|
| T |
32779481 |
gaagaaccaccatcactgctc |
32779501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University