View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5212_low_20 (Length: 226)
Name: NF5212_low_20
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5212_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 35033184 - 35032970
Alignment:
| Q |
7 |
ttattactttcctacnnnnnnnctcattgatgaacatttatttcctactattattgtatatagtagttgtctatttaccttaatgtacttttatactatt |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35033184 |
ttattactttcctactttttttctcattgatgaacatttatttcctactattattgtatatagtagttgtctatttaccttaatgtacttttatactatt |
35033085 |
T |
 |
| Q |
107 |
attggttaatattttattgtgcactaattgattgcagtgaatagaccctgaccctctctcaatatcttaagaatacactagtgaaaatagttactcattt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35033084 |
attggttaatattttattgtgcactaattgattgcagtgaatagaccccgacc--ctctcaatatcttaagaatacactagtgaaaatagttattcattt |
35032987 |
T |
 |
| Q |
207 |
ttacgaatcgaaaaatg |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35032986 |
ttacgaatcgaaaaatg |
35032970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University