View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5212_low_9 (Length: 339)
Name: NF5212_low_9
Description: NF5212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5212_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 7 - 337
Target Start/End: Complemental strand, 26573892 - 26573562
Alignment:
| Q |
7 |
caacattactcgatcggcactgcagtgacttgtcatggacctagacctcttaagattaaccattgggtttattgataaatctcgaaagtcttcaaaagac |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26573892 |
caacattactcgatcagcactgcagtgacttgtcatggacctagacctcttaagattaaccattgggtttattgataaatctcgaaagtcttcaaaagac |
26573793 |
T |
 |
| Q |
107 |
tgtgcctgcaaaggagacaagtattcatttatctgcatacgaacatccctgctttcaaggttagagcacgatctcttgagctttggtgaacccaagaaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26573792 |
tgtgcctgcaaaggagacaagtattcatttatctgcatacgaacatccctgctttcaaggttagagcacgatctcttgagctttggtgaacccaagaaat |
26573693 |
T |
 |
| Q |
207 |
cagtcttttcaataccaggatcactcgcatgtccactattgtttgtatcatcgctctttaggctgtacctatcgctttgatcttcaaactcattggtggc |
306 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26573692 |
cagtctttccaataccaggatcactcgcatgtccactattgtttgtatcagcgctctttcggctgtacctatcgctttgatcttcaaactcattggtggc |
26573593 |
T |
 |
| Q |
307 |
ttggtcgtgatctgttggaccattcctttct |
337 |
Q |
| |
|
||| |||| |||||||||||||| ||||||| |
|
|
| T |
26573592 |
ttgctcgttatctgttggaccatacctttct |
26573562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University