View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5213-Insertion-11 (Length: 328)
Name: NF5213-Insertion-11
Description: NF5213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5213-Insertion-11 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 234 - 328
Target Start/End: Original strand, 14891631 - 14891725
Alignment:
| Q |
234 |
tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatggtgtcactgcttctgcattgttcact |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14891631 |
tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatagtgtcactgcttctgcattgttcact |
14891725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 246 - 328
Target Start/End: Original strand, 14873113 - 14873195
Alignment:
| Q |
246 |
attttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgcatggtgtcactgcttctgcattgttcact |
328 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||| |||||||| || |||||| ||||||||||||||||||| |||||| |
|
|
| T |
14873113 |
attttaggttaccggtgcagttagctggtacacaggtatcattgacaccattgcatagtgtcactgcttctgcattattcact |
14873195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 114 - 164
Target Start/End: Original strand, 14891516 - 14891566
Alignment:
| Q |
114 |
ttcaagcttccccacaaaaacgctcactctcctactccataaggtaaatca |
164 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14891516 |
ttcaagcttccccacaaaaacgcttactctcctactccataaggtaaatca |
14891566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 14891418 - 14891454
Alignment:
| Q |
10 |
agcttcatcttcttctaaaaccctattatctcgtcga |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14891418 |
agcttcatcttcttctaaaaccctattatctcgtcga |
14891454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University