View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5213_high_29 (Length: 293)
Name: NF5213_high_29
Description: NF5213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5213_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 147 - 290
Target Start/End: Complemental strand, 26945428 - 26945286
Alignment:
| Q |
147 |
ggatagagaagaagtgcaacatcacatatatgtcttgctttttgttgggttggcttgtggcttcatgattcttttgttcacatggcttttcggtgctgcc |
246 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
26945428 |
ggatacagaagaagtgcagcatcacatatctgtcttgctttttgttgggttggcttgtggcttcatgatgcttttgttcacatggctatttggtgctgcc |
26945329 |
T |
|
| Q |
247 |
acactcactggtattgaaaatgcagtggtttaatcgtctgtgct |
290 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
26945328 |
acactcactggtattgaaaatg-agtggtttaatcgtttgtgct |
26945286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 27004958 - 27004896
Alignment:
| Q |
147 |
ggatagagaagaagtgcaacatcacatatatgtcttgctttttgttgggttggcttgtggctt |
209 |
Q |
| |
|
|||||| || |||||||| |||||||||| ||||||||||||| ||||||| || |||||||| |
|
|
| T |
27004958 |
ggatagggaggaagtgcagcatcacatatctgtcttgctttttattgggttagcatgtggctt |
27004896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 26990418 - 26990357
Alignment:
| Q |
147 |
ggatagagaagaagtgcaacatcacatatatgtcttgctttttgttgggttggcttgtggct |
208 |
Q |
| |
|
|||||| || |||||||| |||||||||| ||||||||||||| | ||||| || ||||||| |
|
|
| T |
26990418 |
ggatagggaggaagtgcagcatcacatatctgtcttgctttttatcgggttagcatgtggct |
26990357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University