View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5213_high_44 (Length: 215)
Name: NF5213_high_44
Description: NF5213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5213_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 13 - 134
Target Start/End: Complemental strand, 26216672 - 26216551
Alignment:
| Q |
13 |
aatattaactccattttagatatgccaacattgactcaaaatcctcaaagcctggttcttccaacaaagcattttcaaacttgaaccgccgcattgaact |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26216672 |
aatattaactccatttgagatatgccaacattgactcaaaatcctcaaagcctggttctgccaacaaagcattttcaaacttgaaccgccgcgttgaact |
26216573 |
T |
 |
| Q |
113 |
catagaagtcctgatcggatca |
134 |
Q |
| |
|
||||||||| ||||| |||||| |
|
|
| T |
26216572 |
catagaagtactgatgggatca |
26216551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 136 - 196
Target Start/End: Complemental strand, 26216518 - 26216458
Alignment:
| Q |
136 |
agtagttgtcaagcattctagatgtgcattaggaaatgtatgacacaaatcaccatcggtg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
26216518 |
agtagttgtcaagcattctagatgtgcattaggaaatgtttgacacaaatcaccattggtg |
26216458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University