View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5213_low_31 (Length: 293)

Name: NF5213_low_31
Description: NF5213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5213_low_31
NF5213_low_31
[»] chr4 (3 HSPs)
chr4 (147-290)||(26945286-26945428)
chr4 (147-209)||(27004896-27004958)
chr4 (147-208)||(26990357-26990418)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 147 - 290
Target Start/End: Complemental strand, 26945428 - 26945286
Alignment:
147 ggatagagaagaagtgcaacatcacatatatgtcttgctttttgttgggttggcttgtggcttcatgattcttttgttcacatggcttttcggtgctgcc 246  Q
    ||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||    
26945428 ggatacagaagaagtgcagcatcacatatctgtcttgctttttgttgggttggcttgtggcttcatgatgcttttgttcacatggctatttggtgctgcc 26945329  T
247 acactcactggtattgaaaatgcagtggtttaatcgtctgtgct 290  Q
    |||||||||||||||||||||| |||||||||||||| ||||||    
26945328 acactcactggtattgaaaatg-agtggtttaatcgtttgtgct 26945286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 147 - 209
Target Start/End: Complemental strand, 27004958 - 27004896
Alignment:
147 ggatagagaagaagtgcaacatcacatatatgtcttgctttttgttgggttggcttgtggctt 209  Q
    |||||| || |||||||| |||||||||| ||||||||||||| ||||||| || ||||||||    
27004958 ggatagggaggaagtgcagcatcacatatctgtcttgctttttattgggttagcatgtggctt 27004896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 208
Target Start/End: Complemental strand, 26990418 - 26990357
Alignment:
147 ggatagagaagaagtgcaacatcacatatatgtcttgctttttgttgggttggcttgtggct 208  Q
    |||||| || |||||||| |||||||||| ||||||||||||| | ||||| || |||||||    
26990418 ggatagggaggaagtgcagcatcacatatctgtcttgctttttatcgggttagcatgtggct 26990357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University