View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5213_low_42 (Length: 254)
Name: NF5213_low_42
Description: NF5213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5213_low_42 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 52 - 254
Target Start/End: Complemental strand, 45403482 - 45403280
Alignment:
| Q |
52 |
gggattctgtgtgttatattgatattggtacttagttcataatttgtgcatgactattagtggtaatgttagttgtcagtgtttgaactgtgaaactaac |
151 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403482 |
gggattctgtatgttatattgatattggtacttagttcataatttgtgcatgactattagtggtaatgttagttgtcagtgtttgaactgtgaaactaac |
45403383 |
T |
|
| Q |
152 |
tgagatgtctacttggaacttctcttagatactaaaggaataaattctaacaaattttgtgtagtgtatacagttgtgttattttcacccactttgatca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403382 |
tgagatgtctacttggaacttctcttagatactaaaggaataaattctaacaaattttgtgtagtgtatacagttgtgttattttcacccactttgatca |
45403283 |
T |
|
| Q |
252 |
gat |
254 |
Q |
| |
|
||| |
|
|
| T |
45403282 |
gat |
45403280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University