View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5213_low_51 (Length: 214)
Name: NF5213_low_51
Description: NF5213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5213_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 40737516 - 40737327
Alignment:
| Q |
1 |
cttggcttggtacgtggtcaatctatgttgtctatataatcaattatcgatgaccacgaggttataaagtgtttctatactgaannnnnnngagaggttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
40737516 |
cttggcttggtacgtggtcaatctatgttgtctatataatcaattatcgatgaccacgaggttataaaatgtttctatattgaatttttttgagaggttc |
40737417 |
T |
|
| Q |
101 |
tctctattgtattttgtaacgaattgagtgtccatgagcataaacttttgaatgactgtctgatcacatacatgaagaatatgtttgata |
190 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40737416 |
tctctattgaattttgtaagaaatttagtgtccatgagcataaacttttgaatgactgtctgatcacatacatgaagaatatgtttgata |
40737327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University