View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5214-Insertion-3 (Length: 441)
Name: NF5214-Insertion-3
Description: NF5214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5214-Insertion-3 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-142
Query Start/End: Original strand, 160 - 441
Target Start/End: Complemental strand, 6697595 - 6697314
Alignment:
| Q |
160 |
accaagctgcattggtcgaacaacaagtggttatgtgtgatgcctattaatgctgatacataaacgaagagaatctgcacttttcagcagcagatggtaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
6697595 |
accaagctgcattggtcgaacaacaagtggttatgtgtgatgcctattaatgctaatgcataaatgaagagaatctgcaattttcagcagcagatggtaa |
6697496 |
T |
 |
| Q |
260 |
ttttaggggtctaggtaagtatcatttaagagctggtgtttgataaaatttaatcctgcaaaatgctgcaggctgtagactgtactgtttgttttttgtg |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6697495 |
ttttaggggtctaggtaagtatcatttaagagctggtgtttgataaaatttaatcctgcaaaatgctgcaggttgtagactgtactgtttgttttttgtg |
6697396 |
T |
 |
| Q |
360 |
tttggcctctcatgtgaaggctaaattttttgaggttaacttttaggcttggtgagtcttgtgcttgtgtctttgaactgta |
441 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6697395 |
tttggtctctcatgtgaaggctaaattttttgaggttaacttttaggcttggtgaatcttgtgcttgtgtctttgaactgta |
6697314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 11 - 132
Target Start/End: Complemental strand, 6697729 - 6697608
Alignment:
| Q |
11 |
gctttattaccacttgtaccaaacatttagtgcaaattgtgcttgkattgcataattatataagattccttttgggatcaagagaattggtcgtaaaatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6697729 |
gctttattaccacttgtaccaaacatttagtgcaaattgtgcttgtattgcataattatataagattccttttgggatcaagagaattggtcttaaaatt |
6697630 |
T |
 |
| Q |
111 |
ttgaggcctaaaaccattggtg |
132 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6697629 |
ttgaggcctaaaaccattggtg |
6697608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University