View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5214_high_4 (Length: 282)
Name: NF5214_high_4
Description: NF5214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5214_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 6393881 - 6393633
Alignment:
| Q |
14 |
gagacgtacaaattattcggaagaacaaaaattggtgatttttctagatacataactttgaactgatgttgcaggtagagaaagtagcctcaaaaagaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6393881 |
gagacgtacaaattattcggaagaacaaaaattgttgatttttctagatacataactttgaactgatgttgcaggtagagaaagtagcctcaaaaagaaa |
6393782 |
T |
 |
| Q |
114 |
ttcaaggggtcacggggaggacataatctaggacccagtttggttttctggtttgccaattgcactcacaaagtaccctggtattggtattttcttatgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || | ||||| |
|
|
| T |
6393781 |
ttcaaggggtcacggggaggacataatctaggacccagtttggttttctggtttgccaattgccctcacaaagtaccctggtat-----ttggcctatgg |
6393687 |
T |
 |
| Q |
214 |
ttgtaataaaactctatttctgtcttggatgtatctaagcagtctttggttttg |
267 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
6393686 |
ttgtaataaaactctctttctgtcttggatgtatttaagcggtctttggttttg |
6393633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University