View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5215-Insertion-5 (Length: 316)
Name: NF5215-Insertion-5
Description: NF5215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5215-Insertion-5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 8 - 316
Target Start/End: Original strand, 46287715 - 46288023
Alignment:
| Q |
8 |
tttcttctccctaatttttcttccaccgatgttaccctaagacataaatatcatcgtacaaccaagaaacaaaatgaattccactacatcaatagtttcc |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287715 |
tttcttctccctaatttttctttcaccgatgttaccctaagacataaatatcatcgtacaaccaagaaacaaaatgaattccactacatcaatagtttcc |
46287814 |
T |
|
| Q |
108 |
ttgccggaggattgtgtttctgcaatattgtcacatacatcaccacaagatgcatgtagatttttattggtttccaacacttttgtcaaagttgcagatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287815 |
ttgccggaggattgtgtttctgcaatattatcacatacatcaccacaagatgcatgtagatttttattggtttccaacacttttgtcaaagttgcagatt |
46287914 |
T |
|
| Q |
208 |
ctgacttggtttggaagacctttttaccctctgattatgaggacattgtctcaagagctgtgaatcaattctctttcaaattcatctcttcatacaagca |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287915 |
ctgacttggtttggaagacctttttaccctctgattacgaggacattgtctcaagagctgtgaatcaattctctttcaaattcatctcttcatacaagca |
46288014 |
T |
|
| Q |
308 |
actctttcg |
316 |
Q |
| |
|
||||||||| |
|
|
| T |
46288015 |
actctttcg |
46288023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University