View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5215_low_14 (Length: 228)
Name: NF5215_low_14
Description: NF5215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5215_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 46287720 - 46287514
Alignment:
| Q |
18 |
aagaaaactatttgagaggctgtgggttttccaaaactggaactattaaatttggggttgaatttttattatctttatatgtagtcatgacatgacatct |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287720 |
aagaaaactatttgagaggttgtgggttttccaaaactggaactattaaatttggggttgaatttttattatctttatatgtagtcatgacatgacatct |
46287621 |
T |
 |
| Q |
118 |
atgttggcaagtagccagggtaatttgcacattccagccagctatattaaattggtaatttgatttataat---aatagccatctttaactatggatggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
46287620 |
atgttggcaagtagccagggtaatttgcacattccagccaactatattaaattggtaatttgatttataataataatagccatctttaacgttggatggt |
46287521 |
T |
 |
| Q |
215 |
taaatat |
221 |
Q |
| |
|
||||||| |
|
|
| T |
46287520 |
taaatat |
46287514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University