View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5215_low_9 (Length: 263)
Name: NF5215_low_9
Description: NF5215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5215_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 247
Target Start/End: Original strand, 45309177 - 45309408
Alignment:
| Q |
16 |
atgaacttaaggcatcaaaagttatcatcactgaaagtagtagcattcgcagtatacacaatcgttcggtagaactcaagaatttatttggggctgtcat |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45309177 |
atgaacttaaggcatctaaagttatcatcactgaaagtagtagcattcgcagtatacacaatcgttcggtagaactcaagaatttatttggggctgtcat |
45309276 |
T |
 |
| Q |
116 |
tgcctaccaacaatcttgccttgatggcttttctgatacaaaaagtgataataataaggccatgttacatttgcaaacagataactacttggacaatgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45309277 |
tgcctaccaacaatcttgccttgatggcttttctgatacaaaaagtgataataataaggccatgttacatttgcaaacagataactacttggacaatgtt |
45309376 |
T |
 |
| Q |
216 |
ggaaagctcactggtttggcacttgatgttgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45309377 |
ggaaagctcactggtttggcacttgatgttgt |
45309408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University