View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5216-Insertion-4 (Length: 251)
Name: NF5216-Insertion-4
Description: NF5216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5216-Insertion-4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 34058469 - 34058399
Alignment:
| Q |
181 |
cactgtatgaaaaactttcaaatcaacattgaatcttaaaccctaaaaactatagcactgaaaaatttcat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34058469 |
cactgtatgaaaaactttcaaatcaacattgaatcttaaaccctaaaaactatagcactgaaaattttcat |
34058399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University