View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5216_low_5 (Length: 223)
Name: NF5216_low_5
Description: NF5216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5216_low_5 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 29690466 - 29690288
Alignment:
| Q |
1 |
aaaataagttgaatatccacttgagaagagtatgaagatgagttgagtatttgatgagctttcttaaggtataggaactagagaataagtttattgccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
29690466 |
aaaataagttgaatatccacttgagaagagtatgaagatgagttgagtatttgatgagctttcttaaggtataggaactagaaaataagtttattgctaa |
29690367 |
T |
 |
| Q |
101 |
cgcgattctgatcagagggctcatcatgtatggctctagttcttgctttgggtttgtgggatatatggaatggttgtgc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690366 |
cgcgattctgatcagagggctcatcatgtatggctctagttcttgctttgggtttgtgggatatatggaatggttgtgc |
29690288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 40 - 159
Target Start/End: Complemental strand, 27527 - 27412
Alignment:
| Q |
40 |
gagttgagtatttgatgagctttcttaaggtataggaactagagaataagtttattgccaacgcgattctgatcagagggctcatcatgtatggctctag |
139 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| ||| | ||| || |||||||||| || |||||||| ||||||||||||||| ||||| ||| |
|
|
| T |
27527 |
gagttgagtatttcatgaggtttcttaaggtatgggagcaagaaaaggagtttattgctaatgcgattctaatcagagggctcatc----ttggctttag |
27432 |
T |
 |
| Q |
140 |
ttcttgctttgggtttgtgg |
159 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27431 |
ttcttgctttgggtttgtgg |
27412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University