View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5217-Insertion-10 (Length: 198)
Name: NF5217-Insertion-10
Description: NF5217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5217-Insertion-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 7 - 155
Target Start/End: Original strand, 34851338 - 34851485
Alignment:
| Q |
7 |
aaatacttgtaccaattatcattaatgagacaatggaacctagctactacagctcttcaatctactatggtggtcaagaaaattattccccaagaaaaag |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34851338 |
aaatacttgtaccaattatcag-aatgagacaatggaacctagctactacagctcttcaatctactatggtggtcaagaaaattattccccaagaaacag |
34851436 |
T |
|
| Q |
107 |
gaccactgaaccccaccatgttgtgagtgccatcattctcatccttttt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34851437 |
gaccactgaaccccaccatgttgtgagtgccatcattctcatccttttt |
34851485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 92
Target Start/End: Original strand, 31120796 - 31120837
Alignment:
| Q |
51 |
tactacagctcttcaatctactatggtggtcaagaaaattat |
92 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
31120796 |
tactacagttcctcaatctattatggtggtcaagaaaattat |
31120837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University