View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218-Insertion-17 (Length: 247)
Name: NF5218-Insertion-17
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 39146472 - 39146234
Alignment:
| Q |
8 |
gccgtgtcttatcaagtaatcattcactacttgtggatggtgagcacacgtaaaaggtagagggaaactagaatcaacttttctcacagcaagcaatgtc |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||| ||||||||| ||| |
|
|
| T |
39146472 |
gccgtgtcttatcaagtaatcatacactacttgtggatggtgagcacacgtaaaaggtaaatggaaactaaaatcaacttttctcaaagcaagcaaagtc |
39146373 |
T |
|
| Q |
108 |
ctgatttggttaatatgttgaacaaggttcattctaattttggttcgatgttaatgtggttggactttgtcgtgcaattttatttctgtttttgtagcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
39146372 |
ctgatttggttaatatgttgaacaaggttcattccaattttggttcgatgttaatgtggttggactttgtcttgcaattttatttctgtttttggagcaa |
39146273 |
T |
|
| Q |
208 |
ttgtgttcaacacatactcttctgtcttaaaagtcaccta |
247 |
Q |
| |
|
|| ||||||||| ||||||| ||||| ||||||||||| |
|
|
| T |
39146272 |
gtgacttcaacacaaactcttcagtctt-aaagtcaccta |
39146234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University