View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218-Insertion-18 (Length: 237)
Name: NF5218-Insertion-18
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218-Insertion-18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 162 - 237
Target Start/End: Complemental strand, 13649435 - 13649361
Alignment:
| Q |
162 |
tcgaccaggaatcttggcttatcccctttgtgttaccaaatctttcgattttacaaagaatgatgtcgatcagaag |
237 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||| |||||||| |
|
|
| T |
13649435 |
tcgaccgggaatcttggcttatcccctttgtgttaccaaatcttt-gatttcacaaagaatggtgtcaatcagaag |
13649361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University