View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218-Insertion-20 (Length: 44)
Name: NF5218-Insertion-20
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218-Insertion-20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.0000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 6515129 - 6515165
Alignment:
| Q |
8 |
ttatattcatcttgctagctagggacaaccttgtcta |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515129 |
ttatattcatcttgctagctagggacaaccttgtcta |
6515165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University