View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_high_23 (Length: 280)
Name: NF5218_high_23
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 24 - 261
Target Start/End: Complemental strand, 28714317 - 28714080
Alignment:
| Q |
24 |
acagaactacagtctatggattaaaggagcaatctgaatcttagggcaactggaaagatggaaaacaaaatatggaaaaccaacactgaacttcaattgc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28714317 |
acagaactacagtctatggattaaaggagcaatctgaatcttagggtaactggaaagatggaaaacaaaatacggaaaaccaacactgaacttcaattgc |
28714218 |
T |
|
| Q |
124 |
agagataattatgctcgtctattcagttgcacaaagaattggaacaggatagatcctctcaacaaattgcaagttacaaatcacaacttacttcagaaac |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28714217 |
agagataattatgcttgtctattcagttgcacaaagaattggaacaggataggtcctctcaacaaattgcaagttacaaatcacaacttacttcagaaac |
28714118 |
T |
|
| Q |
224 |
aaagtaacttcaaagtccaattactggattcacagttc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28714117 |
aaagtaacttcaaagtccaattactggattcacagttc |
28714080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University