View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5218_high_41 (Length: 239)

Name: NF5218_high_41
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5218_high_41
NF5218_high_41
[»] chr2 (1 HSPs)
chr2 (153-222)||(821633-821702)
[»] chr3 (1 HSPs)
chr3 (34-80)||(45809102-45809148)


Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 222
Target Start/End: Complemental strand, 821702 - 821633
Alignment:
153 aatatttcttaatttgtgcaccgagacaatgtttaggactatcttcatagcagcacatatttcatcaaac 222  Q
    ||||||||||||||||||||||||||||| ||||||||| |  |||||| ||||||||||||||| ||||    
821702 aatatttcttaatttgtgcaccgagacaaagtttaggacgactttcataacagcacatatttcataaaac 821633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 80
Target Start/End: Original strand, 45809102 - 45809148
Alignment:
34 aattcagactcggtattttgtttagcttgcatatttctcagttgcta 80  Q
    ||||||||||| ||||||||||||| |||| ||||||||||||||||    
45809102 aattcagactctgtattttgtttagattgcttatttctcagttgcta 45809148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University