View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_high_50 (Length: 214)
Name: NF5218_high_50
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 24 - 200
Target Start/End: Original strand, 40322411 - 40322587
Alignment:
| Q |
24 |
atggtttccataactccattaatggtttctataatttcatttgatttagataacaaacgaactgggggatcaaattgaaaaaccatgatcaatacttttc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40322411 |
atggtttccataactccattaatggtttctataatttcatttgattgagataacaaacgaactaggggatcaaattgaaaaaccatgattaatacttttc |
40322510 |
T |
|
| Q |
124 |
tgatttttcaagcgaaaagataaattgaaacaaaactagtagcaccatannnnnnngttatggggtattaagtatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
40322511 |
tgatttttcaagcgaaaagataaattgaaacaaaacttgtagcaccatatttttttgttatggggtattaagtatta |
40322587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University