View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_low_30 (Length: 251)
Name: NF5218_low_30
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 39 - 251
Target Start/End: Complemental strand, 28303847 - 28303634
Alignment:
| Q |
39 |
aataatgaggaaaaacatattcattgttggtctattgcattagtagactttcaaaa-ctagcagatttcttgctgaaatattttgacctgtttatcaatc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28303847 |
aataatgaggaaaaacatattcattgttagtctattgcattggtagactttcaaaaactagcagatttcttgctgaaatattttgacctgtttaccaatc |
28303748 |
T |
|
| Q |
138 |
tatctagagtgtgtgtaaatacgatattccttggatttatagcgcgattgagataactaagtttcttaagcatgtaggcagcaggacttcgatataaggt |
237 |
Q |
| |
|
|||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28303747 |
tatctataatgtgtgtgaatacgatattccttggatttatagcgcgattgagataactaagtttcttaagcatgtaggcagcaggacttggatataaggt |
28303648 |
T |
|
| Q |
238 |
tgatgtgtatggaa |
251 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28303647 |
cgatgtgtatggaa |
28303634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University