View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_low_31 (Length: 251)
Name: NF5218_low_31
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 47652187 - 47652426
Alignment:
| Q |
14 |
atatcttagaaaataagaagactcagacactaatatagtttgctgtcacattgacaatttgtgatcaagaaatcggactgattgtaataataataagtct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47652187 |
atatcttagaaaataagaagactcagacactaatatagttagctgtcacattgacaatttgtgatcaagaaatcggactgattgtaataataataagtct |
47652286 |
T |
 |
| Q |
114 |
tgtgattgtt--attgataatcaaagataatatattaattcaaaaaagtataaaaggtactccaatgataatacatataaaatgatatcatcactaatta |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47652287 |
tgtgattgttttattgataatcaaagataatatattaattcaaaaaagtataaaaggtactccaatgataatacatataaaatgatataatcactaatta |
47652386 |
T |
 |
| Q |
212 |
aagtaaatataaacaattataagtgatgtgatttacttct |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47652387 |
aagtaaatataaacaataataagtgatgtgatttacttct |
47652426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University