View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_low_34 (Length: 249)
Name: NF5218_low_34
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 28303507 - 28303292
Alignment:
| Q |
1 |
ttggatcttggtgcaagattcaattgcattgagattcaatgattctacatccgctgcaaaatatatggtcgcattgagtattagagatcgaacgttggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
28303507 |
ttggatcttggtgcaagattcaattgcattgagattcaatgattctacatccgctgcaaaatatatggttgcattgagtattagaggccgaacgttggtt |
28303408 |
T |
|
| Q |
101 |
aaaaattagttacaatagttatgagttagttatactcgtggacacctaaccaaaagactatagggttattagcggttttggcctctaacatctgggttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28303407 |
aaaaattagttacaatagttatgagttagttatactcgt-gacacctaaccaaaagactatagggttattagcggttttggcctcgaacatctgggttat |
28303309 |
T |
|
| Q |
201 |
ggtcttagtccttttaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28303308 |
ggtcttagtccttttaa |
28303292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University