View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_low_41 (Length: 239)
Name: NF5218_low_41
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 153 - 222
Target Start/End: Complemental strand, 821702 - 821633
Alignment:
| Q |
153 |
aatatttcttaatttgtgcaccgagacaatgtttaggactatcttcatagcagcacatatttcatcaaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| | |||||| ||||||||||||||| |||| |
|
|
| T |
821702 |
aatatttcttaatttgtgcaccgagacaaagtttaggacgactttcataacagcacatatttcataaaac |
821633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 80
Target Start/End: Original strand, 45809102 - 45809148
Alignment:
| Q |
34 |
aattcagactcggtattttgtttagcttgcatatttctcagttgcta |
80 |
Q |
| |
|
||||||||||| ||||||||||||| |||| |||||||||||||||| |
|
|
| T |
45809102 |
aattcagactctgtattttgtttagattgcttatttctcagttgcta |
45809148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University