View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5218_low_42 (Length: 238)
Name: NF5218_low_42
Description: NF5218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5218_low_42 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 47652790 - 47652568
Alignment:
| Q |
18 |
acaatacatcacaatcagagagacatgtacagtagctactactctgaatctttctctattctttccccattctcttaacaaactttttcacatggttgcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47652790 |
acaatacatcacaatcagagagacatgtacagtagctactactctgaatctttctctattctttccccattctcttaacaaactttttcacatggttgcc |
47652691 |
T |
|
| Q |
118 |
aacctgtactctttccccactttcccttact--atatctacacactcttcttttatcttttcatggtgtactttgcggtacatttttcacattgctttgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
47652690 |
aacctgtactctttccccactttcccttactatatatctacacactcttcttttatcttttcatggtgtactttgcggtacatatttgacattgctttgg |
47652591 |
T |
|
| Q |
216 |
tcacttctacttgttttactcat |
238 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
47652590 |
tcatttctacttgttttactcat |
47652568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University