View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5219-Insertion-10 (Length: 95)

Name: NF5219-Insertion-10
Description: NF5219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5219-Insertion-10
NF5219-Insertion-10
[»] chr7 (1 HSPs)
chr7 (8-95)||(31822028-31822115)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 31822115 - 31822028
Alignment:
8 tcatattgtcttctcaaagcttaaagccatatcttcttgagattatttcgtctccaccatacacctttcttgagtgtatctcatgcac 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
31822115 tcatattgtcttctcaaagcttaaagccatatcttcttgagattattttgtctccaccatacacctttcttgagtgtatctcatgcac 31822028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University