View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5219_high_7 (Length: 330)
Name: NF5219_high_7
Description: NF5219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5219_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 7046972 - 7046673
Alignment:
| Q |
13 |
aatatcttacacggtaatttccaatcgttttcacttttgctagtgtgtgatcaatttatatgagaagacaataattgagttttcgaattaattcatacag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7046972 |
aatatcttacacggtaatttccaatcgttttcacttttgctagtgtgtgatcaatttatatgagtagacaataattgagttttcgaattaattcatacag |
7046873 |
T |
 |
| Q |
113 |
gtgccagtgtatatagctgagatatcacctcaaaacttgaggggaagtctggtttcagttaaccaggttggtaaataccatcaattagagttaaatttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7046872 |
gtgccagtgtatatagctgagatatcacctcaaaacttgaggggaagtctggtttcggttaaccaggttggtaaataccatcaattagagttaaatttct |
7046773 |
T |
 |
| Q |
213 |
attttggtgctacatttgaataaattatcacttcctagattagtgagctttattttaaatttttgttttctgcatagctttctgtcacacttggaattat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7046772 |
attttggtgctacatttgaataaattatcacttcctagattagtgagctttatttaaaatttttgttttctgcatagctttctgtcacccttggaattat |
7046673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University