View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5219_low_14 (Length: 232)
Name: NF5219_low_14
Description: NF5219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5219_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 118 - 227
Target Start/End: Original strand, 47726909 - 47727019
Alignment:
| Q |
118 |
gacatgtgagaacaatgagagcacctta-tccatgtttgacttatattattgtagctaacattatttgatgagatcgatagaagctcatgaggtgagttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47726909 |
gacatgtgagaacaatgagagcaccttaatccatgtttaacttatattattgtagctaacattatttgatgagatcgagagaagctcatgaggtgagttg |
47727008 |
T |
 |
| Q |
217 |
atatggatcat |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
47727009 |
atatggatcat |
47727019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 47726793 - 47726885
Alignment:
| Q |
1 |
ccgaattgctctctgaatcaatgctcttgtttgtgctaattcttcttcaatcctctccaaactggtcatgttctttctcccatcaccaaactg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47726793 |
ccgaattgctctctgaatcaatgctcttgtttgtgctaaatcttcttcaatcttctccaaactagtcatgttctttctcccatcaccaaactg |
47726885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University