View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5219_low_15 (Length: 212)
Name: NF5219_low_15
Description: NF5219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5219_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 38564562 - 38564772
Alignment:
| Q |
1 |
accactatcacctcctctgtgttctcatcttaaaattcaatagtggctagctagagtcatatatagcaaaacttaatcttttaaatgattgtgcaaagtt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38564562 |
accactatcccctcctctgtgttctcatcttaaaattcaatagtggctagctagagtcatatatagcaaaacttaatcttttaaatgattgtgcaaggtt |
38564661 |
T |
 |
| Q |
101 |
ttattatcatatgatgaatttgaagccgcggtgcatgcatattatgcgttctacgcaagtcaatgataggaggcacgtatagggccac-tcaacttagaa |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
38564662 |
ttattatcatatgatgagtttgaagccgcggtgcatgcatattatgcgttctacgcaagtcaatgataagaggcacgtatagggccacttcaacttagaa |
38564761 |
T |
 |
| Q |
200 |
taatctaccca |
210 |
Q |
| |
|
|| ||||||| |
|
|
| T |
38564762 |
tatcctaccca |
38564772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University