View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5220-Insertion-10 (Length: 311)
Name: NF5220-Insertion-10
Description: NF5220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5220-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 7 - 102
Target Start/End: Complemental strand, 38316082 - 38315987
Alignment:
| Q |
7 |
actcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctgagattacgtttattttagttccgatta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38316082 |
actcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctgagattacgtttattttagttccgatta |
38315987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 238 - 303
Target Start/End: Complemental strand, 38315851 - 38315786
Alignment:
| Q |
238 |
gttattcccttcaaatgattttgcatgatttttattttcttaaattgtggggtagtgatttgcatc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || || ||| || ||||||||| |
|
|
| T |
38315851 |
gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatc |
38315786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 213
Target Start/End: Complemental strand, 38315905 - 38315876
Alignment:
| Q |
184 |
gtagtttgtttcgagtgttattcagcttaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38315905 |
gtagtttgtttcgagtgttattcagcttaa |
38315876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University