View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5220-Insertion-11 (Length: 327)
Name: NF5220-Insertion-11
Description: NF5220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5220-Insertion-11 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 7 - 102
Target Start/End: Complemental strand, 38316082 - 38315987
Alignment:
| Q |
7 |
actcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctgagattacgtttattttagttccgatta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38316082 |
actcttctctcaacatgattttcaattttttcatcttcgagttcagattaaacttcaattgttgagctgagattacgtttattttagttccgatta |
38315987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 238 - 327
Target Start/End: Complemental strand, 38315851 - 38315762
Alignment:
| Q |
238 |
gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatcttgctttcaaacggtggatttgtt |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38315851 |
gttattcccttcaaatgattttgcatgatttttattttcttaagttttgaggttgttatttgcatcttgctttcaaacggtggatttgtt |
38315762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 213
Target Start/End: Complemental strand, 38315905 - 38315876
Alignment:
| Q |
184 |
gtagtttgtttcgagtgttattcagcttaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38315905 |
gtagtttgtttcgagtgttattcagcttaa |
38315876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 327
Target Start/End: Complemental strand, 45144 - 45103
Alignment:
| Q |
286 |
gaggttgttatttgcatcttgctttcaaacggtggatttgtt |
327 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
45144 |
gaggttgttattcacattttgctttcaaacggtggatttgtt |
45103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University