View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5220-Insertion-13 (Length: 204)
Name: NF5220-Insertion-13
Description: NF5220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5220-Insertion-13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 8 - 184
Target Start/End: Original strand, 53638630 - 53638806
Alignment:
| Q |
8 |
tttttaaatacgacagattttattgataatctcctagatcgatcacaagaagaaatcggaaagagggaaaaagttacaaggacactgttaaagcatgaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53638630 |
tttttaaatacgacagattttattgataatctcctagatcgatcacaagaagaaatcggaaagagggaaaaagttacaaggacactgttaaagcatgaaa |
53638729 |
T |
|
| Q |
108 |
aggaacgacgacagagaaccaacaaaaacacctatggccaaagaaatacagtagagcttcccacccaagtcagattc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53638730 |
aggaacgacgacagagaaccaacaaaaacacctatggccaaagaaatacagtagagcttcccatccaagtcagattc |
53638806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University