View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5220-Insertion-6 (Length: 386)
Name: NF5220-Insertion-6
Description: NF5220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5220-Insertion-6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 8 - 386
Target Start/End: Complemental strand, 12683047 - 12682663
Alignment:
| Q |
8 |
gtggcaatggtgaagcctgaggaatgactgatgtttgttgttgcactgttacagttggattttgaacttgctgcggtgtaggtattgctggtatcggtat |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683047 |
gtggcaacggtgaagcctgaggaatgactgatgtttgttgttgcactgttacagttggattttgaacttgctgcggtgtaggtattgctggtatcggtat |
12682948 |
T |
|
| Q |
108 |
cggcaatggtgctgctgctgctggcaacggtactggtgttggtgttggtgt------cggtttcggtgttggggttggtgtagtttcttgcggcgcttgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12682947 |
tggcaatggtgctgctgctgctggcaacggtactggtgttggtgttggtgttggtgtcggtttcggtgttggggttggtatagtttcttgcggcgcttgt |
12682848 |
T |
|
| Q |
202 |
tgctgctgaggaacaatggtactgttgttcaatacaggaggaacaagaatttgttgttcttgttgttcagcaatcttctgcaaaaaagccataacagcag |
301 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682847 |
tgctgctgaggaacaatggtgctgttgttcaatacaggaggaacaagattttgttgttcttgttgttcagcaatcttctgcaaaaaagccataacagcag |
12682748 |
T |
|
| Q |
302 |
catctttggtagcagcaagagatctctcttgagcaagaatttccctttctctattaatcctttgcatctcttgcaacctccaagc |
386 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682747 |
catctttagtagcagcaagagatctctcttgagcaagaatttccctttctctattaatcctttgcatctcttgcaacctccaagc |
12682663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 374
Target Start/End: Original strand, 44553835 - 44553948
Alignment:
| Q |
261 |
ttgttgttcagcaatcttctgcaaaaaagccataacagcagcatctttggtagcagcaagagatctctcttgagcaagaatttccctttctctattaatc |
360 |
Q |
| |
|
||||||||| || || || ||||| |||| ||| || ||||||||||| | |||| | |||||| || || ||||| |||||||| |||||||| || |
|
|
| T |
44553835 |
ttgttgttcggctattttttgcaagaaagacatgactgcagcatcttttgctgcagttatagatctttcgtgtgcaagcatttccctctctctattgatt |
44553934 |
T |
|
| Q |
361 |
ctttgcatctcttg |
374 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44553935 |
ctttgcatctcttg |
44553948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University