View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5220_low_5 (Length: 403)
Name: NF5220_low_5
Description: NF5220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5220_low_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 42687328 - 42686920
Alignment:
| Q |
1 |
ctgcctcgtctccttttcatctcaaagctttcggtgatttcgatagggctacttgccctacttctcgaagatctgtcacaggatactgcgtcttcttggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42687328 |
ctgcctcgtctccttttcatctcaaagctttcggtgattccgatagggctacctgccctacttctcgaagatctgtcacaggatactgcatcttcttggg |
42687229 |
T |
|
| Q |
101 |
tgacactcatttcatggtgttcaaagaagcaagcaattgtatctcattgctcaacagaagctgaataacgtgctctcgctgccagtctaggttacagtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42687228 |
tgacactcatttcatggtgttcaaagaagcaagcaattgtatctcattgctcaacagaagctgaatatcgtgctctcgctgccagtctaggttacagtgt |
42687129 |
T |
|
| Q |
201 |
ctgacttatttacttaga------caggttgcttccattactccagcttttctgtactgtgacggcaaattcacctgtcatattgctgcaaattcaacct |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42687128 |
ctgacttatttacttagagatcttcaggttgcttccattactccagcttttctgtactgtgacggcaaattcacctgtcatattgctgcaaattcaacct |
42687029 |
T |
|
| Q |
295 |
ttcacgagcctattgagcatattgaaatcggttgtcacattgttcgtgagaaactccaaacaaaactctttcggctaatgcacatctcaagcaaagatca |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42687028 |
ttcacgagcctattgagcatattgaaatcggttgtcacaatgttcgcgagaaactccaaacaaaactctttcgactaatgcacatctcaagcaaagatca |
42686929 |
T |
|
| Q |
395 |
attagcggc |
403 |
Q |
| |
|
||||||||| |
|
|
| T |
42686928 |
attagcggc |
42686920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University