View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5221_high_10 (Length: 306)
Name: NF5221_high_10
Description: NF5221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5221_high_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 11 - 306
Target Start/End: Complemental strand, 42480320 - 42480027
Alignment:
| Q |
11 |
cacagacaccttcattcttctacattcttcaaatcaccactacaatctcacagaaacctcatcaatcacaaccatgggttcaacaggtgaaactcaaata |
110 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480320 |
cacacacaccttcattcttccacattcttcaaatcaccactacaatctcaaa--aacctcatcaatcacaaccatgggttcaacaggtgaaactcaaata |
42480223 |
T |
 |
| Q |
111 |
acaccaactcacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcctcagttcttcccatggttttaaaatcagctcttgaacttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480222 |
acaccaactcacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcctcagttcttcccatggttttaaaatcagctcttgaacttg |
42480123 |
T |
 |
| Q |
211 |
atctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctcccaacaactaaccctgaagcaccgg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480122 |
atctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctcccaacaactaaccctgaagcaccgg |
42480027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University