View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5222_high_6 (Length: 247)
Name: NF5222_high_6
Description: NF5222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5222_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 31963685 - 31963447
Alignment:
| Q |
1 |
caaaaatataaatattttttacaa-acatttcaatttaaaaagagtttttatagaatttctacgagtagtactatgaatgataactgaagtaatcaattc |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31963685 |
caaaaatataaatattttttacaagacatttcaatttaaaaaaagtttatatagtatttctacgagtagtactatgaatgataactgaagtaatcaattc |
31963586 |
T |
|
| Q |
100 |
atagaattctataatcaaacttatccaattaaggtcccttgatcattataaacactatcatagtatttgtttccgtcgatgtgtggcttttttagtgccc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31963585 |
atagaattctataatcaaacttatccaattacggtcccttgatcattataaacactatcatagtatttgtttctgtcgatgtgtggcttttttagtgccc |
31963486 |
T |
|
| Q |
200 |
cttttctttcttctttaagctttcgaagttgagtataat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31963485 |
cttttctttcttctttaagctttcgaagttgagaataat |
31963447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 90 - 227
Target Start/End: Complemental strand, 31967713 - 31967577
Alignment:
| Q |
90 |
taatcaattcatagaattctataatcaaacttatccaattaaggtcccttgatcattataaacactatcatagtatttgtttccgtcgatgtgtggcttt |
189 |
Q |
| |
|
|||||| ||||||||| ||||||||||| | ||| ||||||||||| | |||||| |||||||||||||||||| |||||||| |||||| || |||||| |
|
|
| T |
31967713 |
taatcagttcatagaactctataatcaagcctattcaattaaggtctcctgatcactataaacactatcatagtgtttgtttctgtcgatatg-ggcttt |
31967615 |
T |
|
| Q |
190 |
tttagtgccccttttctttcttctttaagctttcgaag |
227 |
Q |
| |
|
|||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
31967614 |
tttactgtcccttttctttcttctttaagctttagaag |
31967577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 145 - 227
Target Start/End: Complemental strand, 31960526 - 31960445
Alignment:
| Q |
145 |
ttataaacactatcatagtatttgtttccgtcgatgtgtggcttttttagtgccccttttctttcttctttaagctttcgaag |
227 |
Q |
| |
|
||||||||| ||||||||| |||||||| | ||||||| || ||||||||||| |||||||| |||| |||||||||| |||| |
|
|
| T |
31960526 |
ttataaacattatcatagtgtttgtttctgacgatgtggggattttttagtgctccttttctctctt-tttaagctttagaag |
31960445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University